Detection of Single Nucleotide Polymorphisms in p53 Mutation Hotspots and Expression of Mutant p53 in Human Cell Lines Using an Enzyme-Linked Electrochemical Assay

Read Also

Petra Horáková^a,b, Eva Šimková^a, Zdenka Vychodilová^a, Marie Brázdová^a and Miroslav Fojta^a*

Recent progress in the utilization of electrochemical techniques in sequence-specific DNA sensing has brought a number of novel applications. It has been shown that electrochemical detection is well suited not only for DNA hybridization sensors (where it is applied to monitor formation of the hybrid duplexes between the surface-immobilized capture probe and a target DNA of interest, or between the target DNA and a specifically labeled reporter probe, reviewed in [1, 2]), but also in connection with other approaches well established in contemporary molecular biology, such as primer extension (PEx) or polymerase chain reactions (PCR). These techniques are based on sequence-specific in vitro synthesis of DNA by elongation of a short oligonucleotide primer forming duplex with a segment in the DNA of interest, catalyzed by DNA polymerases and requiring deoxynucleotide triphosphates (dNTP) as monomeric substrates. Using the PEx, nucleotide sequence of the newly synthesized DNA strand is complementary to the DNA molecule used as a template, while PCR amplifies double-stranded DNA fragments delimited by pair of primers. Both techniques in principle allow incorporation of nucleotide analogues, chemically modified or labeled nucleotides into the synthesized DNA provided that corresponding modified dNTPs are available and suitable as substrates for the DNA polymerases [3-6]. Some of the current arrayed techniques of DNA re-sequencing (such as APEX [7]) involve this principle combined with fluorescent DNA labeling. In our recent papers we reported on application of dNTP conjugates with ferrocene [3], nitrophenyl or aminophenyl tags [4], or tris-bipyridine complexes of osmium or ruthenium [8] as electroactive DNA markers. We showed that the above mentioned labeled dNTPs can serve as convenient tools for the detection of single nucleotide polymorphisms (SNPs) [4, 8].

Another convenient tag for nucleotides to be enzymatically incorporated into DNA is biotin due to the versatility of bioanalytical application of the biotin-(strept)avidin linkage. In particular, enzymes (when coupled to avidin or streptavidin) have often been attached to biotinylated targets and used in various enzyme-linked bioassays, including electrochemical DNA sensing. The enzyme-linked electrochemical techniques employing biotin DNA labeling and streptavidin-enzyme conjugates subsequently attached to the biotin tags have taken the advantage of biocatalytic signal amplification and have been applied by many authors involved in electrochemical DNA sensing (reviewed in [1, 2, 9]). Application of biotinylated (and subsequently enzyme-labeled) reporter probes was combined with both classical (“single-surface”) electrochemical biosensor concept [10] and the “double-surface” [1, 2, 9] techniques. Similarly, using biotinylated dNTPs, PEx-based electrochemical assays have been developed and applied for the detection of various DNA targets [6, 11], including PCR-amplified genomic DNA sequences. We have recently demonstrated applicability of this type of assay in monitoring tissue specific gene expression [6].

The p53 gene is one of the main components of the cell defense against malignant transformation [12]. It encodes a protein that acts as a tumor suppressor via activation of the expression of a number of the genes involved in the cell cycle control, DNA repair or in the programmed cell death. The importance of the p53 gene is underlined by the fact that more than 50 % of human solid tumors are connected with mutation in the p53 gene. The cancer-associated mutations are concentrated in a region encoding the protein core domain responsible for the recognition of the specific DNA sequences within promoters of the p53-controlled genes [13-15]. The most frequent mutations connected with the loss of the p53 tumor suppressor function represent six mutation “hotspots” [16]. Occurrence of the hotspot mutations has been established to have an impact on the cell proneness to becoming a tumor cell and to have implications in efficacy and prognosis of the cancer therapy. Identification of the hotspot mutants is thus an important diagnostic criterion.

In this paper we applied sequence-specific PEx incorporation of the biotinylated nucleotides, in connection with a simple double-surface electrochemical assay, for SNP typing within the p53 hotspot mutation sites. We demonstrate a reliable discrimination between wild and mutant types in the R273H, G245S and R273C hotspots. In addition, using a reverse transcription-PCR technique combined with amplified (thermally cycled) PEx SNP typing protocol we monitor expression of wild type or mutant p53 in human cell lines.

Experimental

Materials

Synthetic oligodeoxynucleotides (ODNs; Table 1) were purchased from VBC Biotech. Pfu DNA polymerase and Streptavidin alkaline phosphatase conjugate were obtained from Promega, Sequenase^TM and Thermo Sequenase^TM form USB, Klenow Fragment, Klenow Fragment (3´-5´exo-), Vent^® (exo-) DNA Polymerase, Therminator^TM DNA Polymerase, Therminator^TM II DNA Polymerase from New England Biolabs, DyNAzyme^TM II DNA Polymerase from Finnzymes, Pwo DNA Polymerase from PEQLAB, unmodified nucleoside triphosphates (dATP, dTTP, dGTP, dCTP) from Sigma, Biotin-16-dUTP (dU^bioTP) from Roche, Biotin-14-dCTP (dC^bioTP) from Invitrogen, 1-naphtyl phosphate disodium salt from Sigma. Other chemicals were of the analytical grade.

Reverse transcription-PCR analysis of p53 expression in human cell lines

Reverse transcription of the total RNA isolated from the U251 [17] or Onda 10 [18] cells was performed using High-Capacity cDNA Reverse Transcription Kits (Applied Biosystems). PCR amplification of the p53 cDNA (the reverse transcript) was performed using p53-for and p53-rev primers (0.5 μM each, sequences: ATGGAGGAGCCGCAGTCAG, TCAGTCTGAGTCAGGCCCTTC), Pfu DNA polymerase (3U) and mix of standard dNTPs (125 μM each) in a total volume of 100 μL. The PCR proceeded in 30 cycles (denaturation 94 °C/90 s, annealing 60 °C/120 s, polymerization 72 °C/180 s). The PCR products were then purified using QIAquick PCR Purification Kit (QIAGEN).

Primer extension with model ODN targets

ODN target template (37.5 nM) was mixed with primer (37.5 nM), DNA polymerase (0.2 - 0.5 U) and dC^bioTP or dU^bioTP (1 μM) in a total volume of 20 μL. The reaction was held at 37 °C using thermolabile polymerases, or at 60-75 °C using thermostable polymerases, for 30 min.

Amplified primer extension with the RT-PCR targets

3.5 ng of the PCR-amplified p53 cDNA fragments and 0.06 μM primer were mixed with the thermostable DNA polymerase (Thermo Sequenase^TM, 0.2 U) and dC^bioTP or dU^bioTP (1 mM) in 20 μL. The reaction was conducted during 20 thermal cycles (94 °C/90 s, 60 °C/120 s, 72 °C/180 s).

Enzyme-linked assay on magnetic beads

The PEx products with the dA₂₅ 5’-overhang in the primer strand were immobilized onto magnetic beads bearing dT₂₅ strands from 20 μL of PEx solution with 0.3 M NaCl during shaking for 30 min. The unbound components of the PEx mixture were removed by triplicate washing of the beads with solution containing 0.3 M NaCl, 10 mM Tris-HCl, pH 7.5 (buffer H). The unoccupied surface of beads was blocked by incubation in 50 μL of milk solution (2.5 g of powdered milk dissolved in 50 mL of PBS - 0.28 M NaCl, 5.5 mM KCl, 24 mM NaHPO₄, 3.5 mM KH₂PO₄, pH 7.4) for 15 min. Then 50 μL of streptavidin-ALP solution (100-times diluted stock in milk-PBS) was added to the beads and the samples were shaken for 30 min, followed by triplicate washing with PBS containing 0.05 % of Tween 20 and triplicate washing with buffer H. Finally, the beads were incubated with 50 μL of 5 mM 1-naphthyl phosphate solution in 0.5 M K₂CO₃, 0.5 M NaHCO₃, pH 9.5 for 30 min under stirring. After incubation, the solution containing enzymatically produced 1-napthol was separated from the beads, added to the background electrolyte (0.5 M K₂CO₃, 0.5 M NaHCO₃, pH 9.5) and analyzed electrochemically. All incubation steps were conducted at 20 °C.

Voltammetric measurements

All measurements were performed with a CHI440 Electrochemical Workstation (CH Instruments, Inc., USA) connected to a three-electrode system (with basal-plane PGE as working, Ag/AgCl/3M KCl as reference and platinum wire as counter electrode). The electroactive indicator 1-naphthol was detected via its electrochemical oxidation using linear sweep voltammetry (LSV) in 0.5 M K₂CO₃ and 0.5 M NaHCO₃, pH 9.5 with initial potential -0.5 V, end potential +0.9 V, scan rate 1 Vs^-1, potential step 5 mV.

Results and Discussion

Our recent work on electrochemical detection of SNP using sequence-specific incorporation of labeled nucleotides into specific positions revealed the usefulness of the PEx-based approaches in connection with the dNTP conjugates bearing various electrochemically active tags [3, 4, 8]. PEx incorporation of multiple biotin tags into specific DNA sequences has recently been used by us to improve sensitivity and specificity of electrochemical detection of PCR-amplified DNA fragments. We applied the technique to monitor plant tissue-specific gene expression [6]. Here we use site specific incorporation of a single biotin-labeled nucleotide, in connection with the magnetic beads (MB)-based “double-surface” detection concept (reviewed in [2, 9]), to discriminate between SNP variants within mutation hotspots R273H, R273C and G245S in tumor suppressor p53 gene.

Principle of the technique applied in this work is depicted in Figure 1. Sequence polymorphism (point mutation) in a target DNA (tDNA) strand is interrogated using a probe that hybridizes with the tDNA upstream (→3’ in the target strand) to the SNP site, which represents the first free (unpaired) nucleotide in the tDNA single-stranded 5’-overhang. The probe serves as a primer to be extended by one nucleotide on the tDNA template. Upon addition of the DNA polymerase and a biotin-labeled dNTP (dN^bioTP) complementary to the first unpaired base, the labeled nucleotide is attached to 3’-end of the probe primer. When the dN^bioTP does not match base pairing with the nucleotide at the SNP position (i.e., when another SNP variant occurs in the tDNA), efficient PEx should not take place and the label should not be introduced under optimum conditions. The probe primers are designed to posses a single-stranded 5’-oligo(A) tail for post-PEx capture at magnetic beads bearing oligo(T) stretches. Streptavidin-alkaline phosphatase conjugate is subsequently attached to the PEx product at the beads. After transferring the MB into a solution of 1-naphthyl phosphate, the latter substrate is enzymatically converted into 1-naphthol serving as an electroactive indicator of the presence of the enzyme – ergo the biotin tag – ergo the SNP type complementary to the dN^bioTP incorporated.

The technique was first tested using synthetic oligonucleotides modeling the p53 hotspot SNP variants (Table 1). In these experiments, the PEx reactions were conducted in a single step using equimolar primer-target pairs (as depicted in Fig. 1) and thermolabile DNA polymerases (such as Klenow fragments or the Sequenase^TM enzyme) at 37 °C. For a PEx reaction with 37.5 nM primer and 37.5 nM wild type (wt) of the G245S hotspot possessing guanine at the SNP position, using dC^bioTP, a well developed peak due to 1-naphthol electrooxidation was observed (Fig. 2A, curve 1). On the other hand, the wt target combined with dU^bioTP yielded only weak signal (Fig. 2A, curve 2) which was probably due to a small frequency of erroneous incorporation of U against G (see below) rather than to non-specific adsorption of the ALP conjugate at the MB or spontaneous substrate hydrolysis (because negative controls without dN^bioTP, without DNA polymerase or without target templates gave zero signals, not shown). For the mutant (mut) type of the G245S hotspot (with adenine at the SNP position of the tDNA), well developed signals were obtained for PEx with dU^bioTP but not dC^bioTP (Fig. 2A, curves 3 and 4, respectively).

We optimized the experimental conditions to reach the best discrimination between SNP types matching or mismatching the complementarity with the dN^bioTP. We tested dependences on the concentrations of the target-primer hybrids (Fig. 2B) and of the dN^bioTPs (not shown), various DNA polymerases (Fig, 3A), and optimized their concentration (activity units added to the PEx reaction, not shown). Based on these experiments, most of the single-step PEx reactions were performed in 20 μL volumes with 37.5 nM primer-target duplexes, 1 mM dN^bioTPs and 0.2 units of DNA polymerase per reaction. Increasing the dN^bioTP and/or enzyme concentrations resulted in more frequent misincorporation of the tags (resulting in false positives), while decreasing concentrations of any of the components below the above-mentioned values caused decreasing detection sensitivity in the true positive (target SNP-dN^bioTP matching) samples.

Special attention was paid to the choice of DNA polymerases providing best fidelity of the biotinylated nucleotide incorporation. We tested both thermolabile polymerases acting at 37 °C and thermostable ones with temperature optima at 60-75 °C; application of the latter is necessary for the thermally cycled PEx reactions (see below). As summarized in Figure 3, individual enzymes differed significantly in both efficiency of the proper incorporation and tendency to misincorporation of either U^bio and C^bio in the single-step PEx with oligonucleotide targets (as in Fig. 2). In general, all polymerases showed more frequent erroneous incorporation of U^bio against G, compared to C^bio against A, due to the formation of the relatively stable G•U wobble pair [19]. Most of the thermostable polymerases were more prone to the U^bio misincorporation than the thermolabile ones; in some of the thermostable polymerases (such as Therminator or Therminator II, Fig. 3B) it was even impossible to distinguish between correct incorporation of C^bio and erroneous incorporation of U^bio to the same site (Fig. 3B). The thermostable enzymes usually exhibited more efficient correct incorporation of the U^bio, compared to the C^bio (Fig. 3B). These data demonstrate the importance of the careful selection of DNA polymerase for attaining sufficient specificity of the PEx reactions. Based on these studies, we selected Klenow (exo-) and Sequenase^TM enzymes as best suited for the single-step PEx reactions at 37 °C (Fig. 3A). For the following thermally cycled PEx, Thermo Sequenase^TM was chosen which – as the only one among the thermostable enzymes – exhibited efficient correct incorporation of both biotinylated nucleotides and sufficiently small frequency of errors featured by U^bio incorporation against G and/or erroneous elongation of the primer by more than one nucleobase.

We focused the next studies on the detection of the expression of the mutant p53 in the in vitro cultured cell lines at the mRNA level using a reverse transcription – PCR protocol [6]. Briefly, total RNA was isolated from cell lines U251 (expressing R273H mutant) and Onda 10 (expressing G245S mutant). The RNA was reversely transcribed and 344 bp fragments of the p53 cDNA (Scheme I) were amplified using gene-specific primers. These fragments were further used as templates for the enzyme-linked electrochemical SNP assay. Our attempts to perform the single-step PEx reactions (as above) with equimolar tDNA/probe primer ratios were unsuccessful due to the large difference in molecular weights of the target (344 bp) and the primer (40 bases), resulting in insufficient sensitivity and suggesting that an amplification of the PEx incorporation is required. Using a thermostable DNA polymerase, it is possible to cycle the PEx reaction similarly as done in the PCR. Since only one primer is used, extension of only one strand takes place and the amount of the PEx products increases linearly with the number of cycles. Thus, when an excess of the primer is added to the reaction, this process results in enrichment of the extended primers bearing the biotinylated nucleotide (in case of complementarity between the dN^bioTP used and the first free nucleobase in the target; see Fig. 4A).

Figure 4B shows results of the amplified PEx experiments obtained for the G245S mutation hotspot in the p53 cDNAs (where G at the SNP position corresponds to the wild type and A to the mutant type). After 20 cycles of the PEx, the PEx products were captured at the MB and further analyzed as described above. For genomic DNA amplicon from the U251 cells, bearing guanine in the G245 hotspot position (corresponding to the wt at this SNP site), a well developed peak N was obtained with dC^bioTP present in the PEx mixture, while reaction with dU^bioTP gave only negligible peak due to the certain frequency of misincorporation. The same experiment with DNA amplicon from the Onda 10 cells which express the G245S p53 mutant was performed. In this case, specific incorporation of U^bio was indicated by an intense peak N, while no signal was obtained after PEx with dC^bioTP. Analogous results were obtained for analysis of the R273H mutation hotspot in the same cDNA amplicons (which is mutant in U251 cells and wt in Onda 10).

Conclusions

We present a primer extension-based enzyme linked electrochemical technique for SNP typing. Due to the sequence specific elongation of a probe primer by a biotinylated nucleotide, reliable discrimination between wild and mutant types of the p53 mutation hotspots R273H, G245S and R273C is attained. We took the advantage of the double-surface MB-based electrochemical bioassays, allowing efficient separation of the PEx products from the reaction mixture containing potentially interfering species (such as proteins, detergents or unreacted biotinylated dNTPs). When combined with the RT-PCR protocol and an amplified (thermally cycled) PEx, analogous technique has been applied to detect wild type or mutant p53 expression in human cell lines. Due to the compatibility of the MB technology with microfluidic systems and the “lab-on-a-chip” concept, the presented approach appears as one of the promising ones for the future development of automated electrochemical devices for genetic screening.